shRNA Lentivirus (self-inactivating), pU6-(FAM49B-shRNA-Seq2)(CAT#: LV-SI0176WQ)

This product is a FAM49B-shRNA encoding Lentivirus, which is based on HIV-1 serotype. FAM49B is a regulator of mitochondrial function and integrity and also inhibits T-cell activation by repressing RAC1 activity and modulating cytoskeleton reorganization. The expression of FAM49B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert FAM49B-shRNA-Seq2
Related Target/Protein FAM49B
Region CDS
TargetSeq GCAAATCGAATGTCTTTGTTT
NCBI RefSeq NM_016623
Alternative Names L1; BM-009
Titer >1*10^10 GC/mL
Related Diseases Pancreatic ductal adenocarcinoma (PDAC)
Target Gene
Gene ID 51571
Uniprot ID Q9NUQ9

Related Products