shRNA Lentivirus (self-inactivating), pU6-(Gm16776-shRNA-Seq6)(CAT#: LV-SI2088WQ)

This product is a Gm16776-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Gm16776 gene can regulate the immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell. The expression of Gm16776-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Gm16776-shRNA-Seq6
Related Target/Protein Gm16776
Region CDS
TargetSeq GTGAGCCAATTTCAGGACATA
NCBI RefSeq XM_355759
Alternative Names Trbv16; Tcrb-V11
Titer >1*10^10 GC/mL
Target Gene
Gene ID 100124680
Uniprot ID A0A0B4J1H3

Related Products