shRNA Lentivirus (self-inactivating), pU6-(GOLGA3-shRNA-Seq1)(CAT#: LV-SI1855WQ)
This product is a GOLGA3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The GOLGA3 gene participates in glycosylation and transport of proteins and lipids in the secretory pathway. The expression of GOLGA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | GOLGA3-shRNA-Seq1 |
Related Target/Protein | GOLGA3 |
Region | 3UTR |
TargetSeq | CCAGAGTTACTTCAGTGCATA |
NCBI RefSeq | NM_005895 |
Alternative Names | MEA-2; GCP170 |
Titer | >1*10^10 GC/mL |