shRNA Lentivirus (self-inactivating), pU6-(GOLGA3-shRNA-Seq1)(CAT#: LV-SI1855WQ)

Datasheet

This product is a GOLGA3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The GOLGA3 gene participates in glycosylation and transport of proteins and lipids in the secretory pathway. The expression of GOLGA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert GOLGA3-shRNA-Seq1
Related Target/Protein GOLGA3
Region 3UTR
TargetSeq CCAGAGTTACTTCAGTGCATA
NCBI RefSeq NM_005895
Alternative Names MEA-2; GCP170
Titer >1*10^10 GC/mL
Target Gene
Gene ID 2802
Uniprot ID Q08378

Related Products

shRNA Lentivirus (self-inactivating), p7SK-(YPEL3-shRNA-Seq1) (CAT#:LV-SI1158WQ) shRNA Lentivirus (self-inactivating), p7SK-(Cyb5d2-shRNA-Seq7) (CAT#:LV-SI3742WQ) shRNA Lentivirus (self-inactivating), pU6-(Csn1s2a-shRNA-Seq3) (CAT#:LV-SI1845WQ) shRNA Lentivirus (self-inactivating), p7SK-(CCDC67-shRNA-Seq3) (CAT#:LV-SI1198WQ) shRNA Lentivirus (self-inactivating), p7SK-(Olfr750-shRNA-Seq6) (CAT#:LV-SI3760WQ) shRNA Lentivirus (self-inactivating), pU6-(LY6G6D-shRNA-Seq2) (CAT#:LV-SI0168WQ) shRNA Lentivirus (self-inactivating), pU6-(Atxn7l1-shRNA-Seq1) (CAT#:LV-SI1856WQ) shRNA Lentivirus (self-inactivating), pU6-(LSM14B-shRNA-Seq1) (CAT#:LV-SI0419WQ)