shRNA Lentivirus (self-inactivating), pU6-(Gsdma3-shRNA-Seq1)(CAT#: LV-SI2329WQ)
This product is a Gsdma3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Gsdma3 gene may play a role in the transition from catagen to telogen at the end of hair follicle morphogenesis. The expression of Gsdma3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Gsdma3-shRNA-Seq1 |
Related Target/Protein | Gsdma3 |
Region | CDS |
TargetSeq | GCTCTGACAGAGCTAACTGAA |
NCBI RefSeq | NM_001007461 |
Alternative Names | Bsk; Dfl; Fgn; Rco2; Rim3; Gsdm3; Gsdm1l |
Titer | >1*10^10 GC/mL |