shRNA Lentivirus (self-inactivating), pU6-(Gsdma3-shRNA-Seq1)(CAT#: LV-SI2329WQ)
This product is a Gsdma3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Gsdma3 gene may play a role in the transition from catagen to telogen at the end of hair follicle morphogenesis. The expression of Gsdma3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Gsdma3-shRNA-Seq1 |
| Related Target/Protein | Gsdma3 |
| Region | CDS |
| TargetSeq | GCTCTGACAGAGCTAACTGAA |
| NCBI RefSeq | NM_001007461 |
| Alternative Names | Bsk; Dfl; Fgn; Rco2; Rim3; Gsdm3; Gsdm1l |
| Titer | >1*10^10 GC/mL |
