shRNA Lentivirus (self-inactivating), pU6-(Gvin1-shRNA-Seq6)(CAT#: LV-SI1758WQ)

This product is a Gvin1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Gvin1 gene belongs to the TRAFAC class dynamin-like GTPase superfamily. The expression of Gvin1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Gvin1-shRNA-Seq6
Related Target/Protein Gvin1
Region 3UTR
TargetSeq GAGATTGTTCCTTCGTAAATA
NCBI RefSeq NM_029000
Alternative Names GVIN1; VLIG1; GVIN1P; VLIG-1; GVINP1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 387751
Uniprot ID Q7Z2Y8

Related Products