shRNA Lentivirus (self-inactivating), pU6-(HSPA13-shRNA-Seq1)(CAT#: LV-SI0361WQ)
This product is a HSPA13-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by HSPA13 gene is a member of the heat shock protein 70 family and is found associated with microsomes. Members of this protein family play a role in the processing of cytosolic and secretory proteins, as well as in the removal of denatured or incorrectly-folded proteins. The expression of HSPA13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | HSPA13-shRNA-Seq1 |
| Related Target/Protein | HSPA13 |
| Region | CDS |
| TargetSeq | CCTAAAGTGATTGGTATTGAT |
| NCBI RefSeq | NM_006948 |
| Alternative Names | STCH |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Oral Cancer |