shRNA Lentivirus (self-inactivating), pU6-(JMJD4-shRNA-Seq2)(CAT#: LV-SI0115WQ)
This product is a JMJD4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. JMJD proteins are mostly epigenetic regulators that demethylate histones. The expression of JMJD4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | JMJD4-shRNA-Seq2 |
| Related Target/Protein | JMJD4 |
| Region | 3UTR |
| TargetSeq | GAATCCCATCTGCTGCTGAAT |
| NCBI RefSeq | NM_023007 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |
