shRNA Lentivirus (self-inactivating), pU6-(KIAA0513-shRNA-Seq1)(CAT#: LV-SI0243WQ)
This product is a KIAA0513-shRNA encoding Lentivirus, which is based on HIV-1 serotype. KIAA0513, a novel signaling molecule that interacts with modulators of neuroplasticity, apoptosis, and the cytoskeleton. The expression of KIAA0513-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | KIAA0513-shRNA-Seq1 |
| Related Target/Protein | KIAA0513 |
| Region | CDS |
| TargetSeq | CAAGAAGCTGTGCAATGACTT |
| NCBI RefSeq | NM_014732 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Pancreatic carcinoma |