shRNA Lentivirus (self-inactivating), pU6-(KIAA1841-shRNA-Seq3)(CAT#: LV-SI0220WQ)

Datasheet

This product is a KIAA1841-shRNA encoding Lentivirus, which is based on HIV-1 serotype. KIAA1841 is targeted for the nucleus and it predicted to play a role in regulating transcription. The expression of KIAA1841-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert KIAA1841-shRNA-Seq3
Related Target/Protein KIAA1841
Region CDS
TargetSeq GCAAGTTCATTGAATACTGTT
NCBI RefSeq NM_032506
Titer >1*10^10 GC/mL
Related Diseases Lung adenocarcinoma
Target Gene
Gene ID 84542
Uniprot ID Q6NSI8

Related Products

Recombinant lentivirus, pU6-(Human NR4A1), Overexpression (CAT#:Lenti-GTOH0423WQ) shRNA Lentivirus (self-inactivating), p7SK-(OR2T34-shRNA-Seq1) (CAT#:LV-SI3223WQ) shRNA Lentivirus (self-inactivating), p7SK-(Chst15-shRNA-Seq1) (CAT#:LV-SI3450WQ) shRNA Lentivirus (self-inactivating), pH1-(NLRP9-shRNA-Seq2) (CAT#:LV-SI2366WQ) Recombinant lentivirus, pU6-(Human PTEN), Overexpression (CAT#:Lenti-GTOH0142WQ) shRNA Lentivirus (self-inactivating), pU6-(Phf14-shRNA-Seq1) (CAT#:LV-SI2234WQ) shRNA Lentivirus (self-inactivating), pH1-(LRRC49-shRNA-Seq2) (CAT#:LV-SI0822WQ) shRNA Lentivirus (self-inactivating), pH1-(Gpatch2-shRNA-Seq1) (CAT#:LV-SI2675WQ)