shRNA Lentivirus (self-inactivating), pU6-(KIAA1919-shRNA-Seq1)(CAT#: LV-SI0171WQ)

This product is a KIAA1919-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The KIAA1919 gene may function as a sodium-dependent glucose transporter is potential channel for urea in the inner medulla of kidney. The expression of KIAA1919-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert KIAA1919-shRNA-Seq1
Related Target/Protein KIAA1919
Region CDS
TargetSeq GCAGGCCTTACACTTCTCTTT
NCBI RefSeq NM_153369
Alternative Names NaGLT1; MFSD4B
Titer >1*10^10 GC/mL
Related Diseases Renal carcinoma
Target Gene
Gene ID 91749
Uniprot ID Q5TF39

Related Products