shRNA Lentivirus (self-inactivating), pU6-(KIAA1919-shRNA-Seq2)(CAT#: LV-SI0172WQ)
This product is a KIAA1919-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The KIAA1919 gene may function as a sodium-dependent glucose transporter is potential channel for urea in the inner medulla of kidney. The expression of KIAA1919-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | KIAA1919-shRNA-Seq2 |
Related Target/Protein | KIAA1919 |
Region | 3UTR |
TargetSeq | CTCACTGACATCTTTGAATAA |
NCBI RefSeq | NM_153369 |
Alternative Names | NaGLT1; MFSD4B |
Titer | >1*10^10 GC/mL |
Related Diseases | Renal carcinoma |