shRNA Lentivirus (self-inactivating), pU6-(Krtap26-1-shRNA-Seq1)(CAT#: LV-SI2240WQ)
This product is a Krtap26-1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Krtap26-1 gene is essential for the formation of a rigid and resistant hair shaft. The expression of Krtap26-1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Krtap26-1-shRNA-Seq1 |
| Related Target/Protein | Krtap26-1 |
| Region | 3UTR |
| TargetSeq | GCTTCTTTCTGAGTAGCGATT |
| NCBI RefSeq | NM_027105 |
| Titer | >1*10^10 GC/mL |
