shRNA Lentivirus (self-inactivating), pU6-(LGI4-shRNA-Seq2)(CAT#: LV-SI0092WQ)
This product is a LGI4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The LGI4 gene encoded protein is component of Schwann cell signaling pathway(s) that controls axon segregation and myelin formation (By similarity). The expression of LGI4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | LGI4-shRNA-Seq2 |
| Related Target/Protein | LGI4 |
| Region | CDS |
| TargetSeq | GATCTACCAGCATCACGAGAT |
| NCBI RefSeq | NM_139284 |
| Alternative Names | LGIL3; AMCNMY |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Neurological diseases |