shRNA Lentivirus (self-inactivating), pU6-(LOC392563-shRNA-Seq3)(CAT#: LV-SI1566WQ)

This product is a LOC392563-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by LOC392563 gene is a component of the mature neuronal cytoskeleton, and it interacts with the zygosome, which is mediated by neurofilament-related proteins. The expression of LOC392563-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert LOC392563-shRNA-Seq3
Related Target/Protein LOC392563
Region CDS
TargetSeq CCGGATAATTACGATCCGATA
NCBI RefSeq XM_373382
Titer >1*10^10 GC/mL
Related Diseases Neurodegenerative diseases

Related Products