shRNA Lentivirus (self-inactivating), pU6-(LRRC47-shRNA-Seq1)(CAT#: LV-SI0445WQ)
This product is a LRRC47-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The LRRC47 gene encodes a protein that significantly changed phosphorylation state in response to short-term vasopressin treatment. The expression of LRRC47-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | LRRC47-shRNA-Seq1 |
| Related Target/Protein | LRRC47 |
| Region | CDS |
| TargetSeq | GTGATTTCCTTCCCACCAATA |
| NCBI RefSeq | NM_020710 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Short-term vasopressin |