shRNA Lentivirus (self-inactivating), pU6-(Lysmd1-shRNA-Seq1)(CAT#: LV-SI2285WQ)

This product is a Lysmd1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Lysmd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Lysmd1-shRNA-Seq1
Related Target/Protein Lysmd1
Region 3UTR
TargetSeq CCACTTCATATGTATCTGTAA
NCBI RefSeq NM_028134
Alternative Names SB145
Titer >1*10^10 GC/mL
Target Gene
Gene ID 388695
Uniprot ID Q96S90

Related Products