shRNA Lentivirus (self-inactivating), pU6-(Med25-shRNA-Seq1)(CAT#: LV-SI2221WQ)
This product is a Med25-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Med25 gene plays a role in chromatin modification and in preinitiation complex assembly. Mutations in this gene are associated with Charcot-Marie-Tooth disease type 2B2. The expression of Med25-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Med25-shRNA-Seq1 |
| Related Target/Protein | Med25 |
| Region | CDS |
| TargetSeq | GCAGCTGTTCGATGACTTTAA |
| NCBI RefSeq | NM_029365 |
| Alternative Names | P78; ACID1; ARC92; BVSYS; PTOV2; CMT2B2; TCBAP0758 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Charcot-Marie-Tooth disease type 2B2 |
