shRNA Lentivirus (self-inactivating), pU6-(Mrpl14-shRNA-Seq1)(CAT#: LV-SI2342WQ)
This product is a Mrpl14-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Mrpl14 gene encodes a protein component of the 39S subunit of the mitochondrial ribosome. The expression of Mrpl14-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Mrpl14-shRNA-Seq1 |
| Related Target/Protein | Mrpl14 |
| Region | CDS |
| TargetSeq | CCTCATTGAGGACAATGGCAA |
| NCBI RefSeq | NM_026732 |
| Alternative Names | L14mt; L32mt; MRPL32; RMPL32; RPML32; MRP-L14; MRP-L32 |
| Titer | >1*10^10 GC/mL |
