shRNA Lentivirus (self-inactivating), pU6-(MUM1L1-shRNA-Seq1)(CAT#: LV-SI0454WQ)
This product is a MUM1L1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The MUM1L1 gene encodes a protein which contains a mutated melanoma-associated antigen 1 domain. The expression of MUM1L1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | MUM1L1-shRNA-Seq1 |
Related Target/Protein | MUM1L1 |
Region | CDS |
TargetSeq | CACATCCGTTTGAAACAGGAA |
NCBI RefSeq | NM_152423 |
Alternative Names | MUM1L1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Endometrial carcinoma |