shRNA Lentivirus (self-inactivating), pU6-(NCRNA00085-shRNA-Seq2)(CAT#: LV-SI0110WQ)

This product is a NCRNA00085-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The NCRNA00085 gene encode the sperm protein potentially involved sperm-egg fusion. The expression of NCRNA00085-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert NCRNA00085-shRNA-Seq2
Related Target/Protein NCRNA00085
Region CDS
TargetSeq CAGAGGAGAAAGGCTCAAAGA
NCBI RefSeq NM_207324
Alternative Names LET7EH; SPACA6P; LINC00085; SPACA6
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 147650
Uniprot ID W5XKT8

Related Products