shRNA Lentivirus (self-inactivating), pU6-(NCRNA00207-shRNA-Seq2)(CAT#: LV-SI0330WQ)
This product is a NCRNA00207-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of NCRNA00207-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | NCRNA00207-shRNA-Seq2 |
| Related Target/Protein | NCRNA00207 |
| Region | CDS |
| TargetSeq | CAGAATCAGATGAAGACTCCT |
| NCBI RefSeq | NM_001012986 |
| Alternative Names | LINC00207 |
| Titer | >1*10^10 GC/mL |
| Target Gene | |
|---|---|
| Gene ID | 388910 |
