shRNA Lentivirus (self-inactivating), pU6-(Obfc1-shRNA-Seq1)(CAT#: LV-SI2350WQ)
This product is a Obfc1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Obfc1 gene appears to function in a telomere-associated complex with C17ORF68 and TEN1. The expression of Obfc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Obfc1-shRNA-Seq1 |
Related Target/Protein | Obfc1 |
Region | CDS |
TargetSeq | GCAGCAGAAGATCTACCACAT |
NCBI RefSeq | NM_175360 |
Alternative Names | AAF44; OBFC1; AAF-44; RPA-32; bA541N10.2; STN1 |
Titer | >1*10^10 GC/mL |