shRNA Lentivirus (self-inactivating), pU6-(Obfc1-shRNA-Seq1)(CAT#: LV-SI2350WQ)

Datasheet

This product is a Obfc1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Obfc1 gene appears to function in a telomere-associated complex with C17ORF68 and TEN1. The expression of Obfc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Obfc1-shRNA-Seq1
Related Target/Protein Obfc1
Region CDS
TargetSeq GCAGCAGAAGATCTACCACAT
NCBI RefSeq NM_175360
Alternative Names AAF44; OBFC1; AAF-44; RPA-32; bA541N10.2; STN1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 79991
Uniprot ID Q9H668

Related Products

shRNA Lentivirus (self-inactivating), pU6-(C6orf141-shRNA-Seq3) (CAT#:LV-SI0310WQ) shRNA Lentivirus (self-inactivating), p7SK-(C1orf212-shRNA-Seq3) (CAT#:LV-SI1294WQ) shRNA Lentivirus (self-inactivating), pU6-(OR8J3-shRNA-Seq2) (CAT#:LV-SI2111WQ) shRNA Lentivirus (self-inactivating), p7SK-(Mrpl53-shRNA-Seq3) (CAT#:LV-SI3577WQ) Recombinant lentivirus, pU6-(Human IL13RA2), Overexpression (CAT#:Lenti-GTOH0170WQ) shRNA Lentivirus (self-inactivating), p7SK-(Gpatch2-shRNA-Seq5) (CAT#:LV-SI3529WQ) Recombinant lentivirus, pU6-(Mouse GGPS1), Overexpression (CAT#:Lenti-GTOH0137WQ) shRNA Lentivirus (self-inactivating), pH1-(OR2V2-shRNA-Seq1) (CAT#:LV-SI2494WQ)