shRNA Lentivirus (self-inactivating), pU6-(Olfr1116-ps-shRNA-Seq1)(CAT#: LV-SI2267WQ)

This product is a Olfr1116-ps-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Olfr1116-ps gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr1116-ps-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Olfr1116-ps-shRNA-Seq1
Related Target/Protein Olfr1116-ps
Region CDS
TargetSeq CCAAGAATGCTTATGGATTTA
NCBI RefSeq NM_001011734
Alternative Names MOR264-8P; MOR264-21P; Olfr1116; Olfr1521-ps1
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 257875
Uniprot ID A0A1L1SRZ5

Related Products