shRNA Lentivirus (self-inactivating), pU6-(OR10A3-shRNA-Seq5)(CAT#: LV-SI1545WQ)
This product is a OR10A3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR10A3 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR10A3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | OR10A3-shRNA-Seq5 |
Related Target/Protein | OR10A3 |
Region | CDS |
TargetSeq | CCTGATGGGAAATGCCATCAT |
NCBI RefSeq | XM_291986 |
Alternative Names | HTPCRX12; HSHTPCRX12 |
Titer | >1*10^10 GC/mL |
Related Diseases | Olfactory dysfunction |