shRNA Lentivirus (self-inactivating), pU6-(Patl2-shRNA-Seq1)(CAT#: LV-SI2321WQ)
This product is a Patl2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Patl2 gene encodes a RNA-binding protein that acts as a translational repressor. The expression of Patl2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Patl2-shRNA-Seq1 |
Related Target/Protein | Patl2 |
Region | CDS |
TargetSeq | CAGGGTTGAGTTTCTCCAGTT |
NCBI RefSeq | NM_026251 |
Alternative Names | OOMD4; Pat1a; hPat1a |
Titer | >1*10^10 GC/mL |