shRNA Lentivirus (self-inactivating), pU6-(PCOLCE-shRNA-Seq1)(CAT#: LV-SI0403WQ)
This product is a PCOLCE-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The PCOLCE gene encodes a glycoprotein which binds and drives the enzymatic cleavage of type I procollagen and heightens C-proteinase activity. The expression of PCOLCE-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | PCOLCE-shRNA-Seq1 |
| Related Target/Protein | PCOLCE |
| Region | CDS |
| TargetSeq | GAATGAACTCCTCGTCCAGTT |
| NCBI RefSeq | NM_002593 |
| Alternative Names | PCPE; PCPE1; PCPE-1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Psoriatic arthritis |