shRNA Lentivirus (self-inactivating), pU6-(PIGX-shRNA-Seq1)(CAT#: LV-SI2047WQ)

This product is a PIGX-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The PIGX gene encodes a type I transmembrane protein in the endoplasmic reticulum (ER) and the protein is an essential component of glycosylphosphatidylinositol-mannosyltransferase I. The expression of PIGX-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert PIGX-shRNA-Seq1
Related Target/Protein PIGX
Region CDS
TargetSeq GAAGCCTCGATTGTGGTCAAT
NCBI RefSeq NM_017861
Alternative Names PIG-X
Titer >1*10^10 GC/mL
Target Gene
Gene ID 54965
Uniprot ID Q8TBF5

Related Products