shRNA Lentivirus (self-inactivating), pU6-(Pof1b-shRNA-Seq4)(CAT#: LV-SI1775WQ)

This product is a Pof1b-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Pof1b gene is expressed at trace levels in mouse prenatal ovary and is barely detectable or absent from adult ovary, in human and in the mouse respectively. The expression of Pof1b-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Pof1b-shRNA-Seq4
Related Target/Protein Pof1b
Region CDS
TargetSeq GAACTCTCAAAGTTGAGACAA
NCBI RefSeq NM_181579
Alternative Names POF; POF2B
Titer >1*10^10 GC/mL
Related Diseases Premature ovarian failure
Target Gene
Gene ID 79983
Uniprot ID Q8WVV4

Related Products