shRNA Lentivirus (self-inactivating), pU6-(PRM2-shRNA-Seq1)(CAT#: LV-SI0395WQ)
This product is a PRM2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The PRM2 gene encodes protamine 2, which is cleaved to give rise to a family of protamine 2 peptides. The expression of PRM2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | PRM2-shRNA-Seq1 |
| Related Target/Protein | PRM2 |
| Region | CDS |
| TargetSeq | GCAGAACCAGGAAGAGAACAT |
| NCBI RefSeq | NM_002762 |
| Alternative Names | CT94.2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Prostate cancer |