shRNA Lentivirus (self-inactivating), pU6-(Psme4-shRNA-Seq3)(CAT#: LV-SI1723WQ)
This product is a Psme4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Psme4 gene is associated component of the proteasome that specifically recognizes acetylated histones and promotes ATP- and ubiquitin-independent degradation of core histones during spermatogenesis and DNA damage response. The expression of Psme4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Psme4-shRNA-Seq3 |
| Related Target/Protein | Psme4 |
| Region | CDS |
| TargetSeq | GCAAAGAAATCTGCCTTGGAA |
| NCBI RefSeq | NM_134013 |
| Alternative Names | PA200 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |