shRNA Lentivirus (self-inactivating), pU6-(RBM33-shRNA-Seq1)(CAT#: LV-SI2105WQ)

This product is a RBM33-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of RBM33-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert RBM33-shRNA-Seq1
Related Target/Protein RBM33
Region CDS
TargetSeq GAAAGCCATAGCTAAGTTCAA
NCBI RefSeq NM_001008408
Alternative Names PRR8
Titer >1*10^10 GC/mL
Target Gene
Gene ID 155435
Uniprot ID Q96EV2

Related Products