shRNA Lentivirus (self-inactivating), pU6-(S1pr4-shRNA-Seq1)(CAT#: LV-SI2323WQ)
This product is a S1pr4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The S1pr4 gene is a member of the endothelial differentiation, G-protein-coupled (EDG)) receptor gene family. The expression of S1pr4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | S1pr4-shRNA-Seq1 |
| Related Target/Protein | S1pr4 |
| Region | CDS |
| TargetSeq | CTCATTGTCCTGCACTACAAT |
| NCBI RefSeq | NM_010102 |
| Alternative Names | EDG6; LPC1; S1P4; SLP4 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lymphoma |
