shRNA Lentivirus (self-inactivating), pU6-(SCAF1-shRNA-Seq3)(CAT#: LV-SI0280WQ)
This product is a SCAF1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SCAF1 may function in pre-mRNA splicing. The expression of SCAF1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SCAF1-shRNA-Seq3 |
| Related Target/Protein | SCAF1 |
| Region | CDS |
| TargetSeq | CACAGATAAGTATCTGAAGAA |
| NCBI RefSeq | NM_021228 |
| Alternative Names | SRA1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Atherosclerosis |
