shRNA Lentivirus (self-inactivating), pU6-(Selm-shRNA-Seq1)(CAT#: LV-SI2302WQ)
This product is a Selm-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Selm gene belongs to the selenoprotein M/SEP15 family and may be involved in neurodegenerative disorders. The expression of Selm-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Selm-shRNA-Seq1 |
| Related Target/Protein | Selm |
| Region | CDS |
| TargetSeq | CTGTGGAGGATGACAGTTGAA |
| NCBI RefSeq | NM_053267 |
| Alternative Names | SELM; SEPM; SELENOM |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Neurodegenerative disorders |
