shRNA Lentivirus (self-inactivating), pU6-(SF3B4-shRNA-Seq4)(CAT#: LV-SI0042WQ)
This product is a SF3B4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by SF3B4 gene cross-links to a region in the pre-mRNA immediately upstream of the branchpoint sequence in pre-mRNA in the prespliceosomal complex A. It also may be involved in the assembly of the B, C and E spliceosomal complexes. In addition to RNA-binding activity, this protein interacts directly and highly specifically with subunit 2 of the splicing factor 3B. The expression of SF3B4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SF3B4-shRNA-Seq4 |
| Related Target/Protein | SF3B4 |
| Region | CDS |
| TargetSeq | CGTCCTATCACCGTATCTTAT |
| NCBI RefSeq | NM_005850 |
| Alternative Names | AFD1; Hsh49; SAP49; SF3b49 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hepatocellular carcinoma |