shRNA Lentivirus (self-inactivating), pU6-(SPIRE2-shRNA-Seq2)(CAT#: LV-SI0262WQ)
This product is a SPIRE2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SPIRE2 acts as an actin nucleation factor, remains associated with the slow-growing pointed end of the new filament and is involved in intracellular vesicle transport along actin fibers, providing a novel link between actin cytoskeleton dynamics and intracellular transport. The expression of SPIRE2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | SPIRE2-shRNA-Seq2 |
Related Target/Protein | SPIRE2 |
Region | 3UTR |
TargetSeq | CATGATGAAATGTTGTCTCTA |
NCBI RefSeq | NM_032451 |
Alternative Names | Spir-2 |
Titer | >1*10^10 GC/mL |