shRNA Lentivirus (self-inactivating), pU6-(SPIRE2-shRNA-Seq2)(CAT#: LV-SI0262WQ)
This product is a SPIRE2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SPIRE2 acts as an actin nucleation factor, remains associated with the slow-growing pointed end of the new filament and is involved in intracellular vesicle transport along actin fibers, providing a novel link between actin cytoskeleton dynamics and intracellular transport. The expression of SPIRE2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SPIRE2-shRNA-Seq2 |
| Related Target/Protein | SPIRE2 |
| Region | 3UTR |
| TargetSeq | CATGATGAAATGTTGTCTCTA |
| NCBI RefSeq | NM_032451 |
| Alternative Names | Spir-2 |
| Titer | >1*10^10 GC/mL |