shRNA Lentivirus (self-inactivating), pU6-(Srbd1-shRNA-Seq2)(CAT#: LV-SI1761WQ)

This product is a Srbd1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Srbd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Srbd1-shRNA-Seq2
Related Target/Protein Srbd1
Region 3UTR
TargetSeq GCCACTTTATTGAGGTGTTAT
NCBI RefSeq NM_030133
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55133
Uniprot ID Q8N5C6

Related Products