shRNA Lentivirus (self-inactivating), pU6-(SUN5-shRNA-Seq1)(CAT#: LV-SI0070WQ)

This product is a SUN5-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SUN5 encoded by this gene appears to play a role in the meiotic stage of spermatogenesis. The encoded protein localizes to the junction between the sperm head and body and may be involved in nuclear envelope reconstitution and nuclear migration. Mutations in this gene have been implicated in acephalic spermatozoa syndrome. The expression of SUN5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SUN5-shRNA-Seq1
Related Target/Protein SUN5
Region CDS
TargetSeq GTTCTGTTTAACACGTGCAGA
NCBI RefSeq NM_080675
Alternative Names SPAG4L; SPGF16; TSARG4; dJ726C3.1
Titer >1*10^10 GC/mL
Related Diseases Acephalic spermatozoa syndrome
Target Gene
Gene ID 140732
Uniprot ID Q8TC36

Related Products