shRNA Lentivirus (self-inactivating), pU6-(Svs3a-shRNA-Seq1)(CAT#: LV-SI2251WQ)
This product is a Svs3a-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Svs3a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Svs3a-shRNA-Seq1 |
| Related Target/Protein | Svs3a |
| Region | CDS |
| TargetSeq | GAAGACATAGTTTGTGAAGAA |
| NCBI RefSeq | NM_021363 |
| Alternative Names | Svp3; Svs3; Semg2; Svp-3; BB121242; 9530026M05Rik |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |