shRNA Lentivirus (self-inactivating), pU6-(Svs3a-shRNA-Seq1)(CAT#: LV-SI2251WQ)
This product is a Svs3a-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Svs3a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Svs3a-shRNA-Seq1 |
Related Target/Protein | Svs3a |
Region | CDS |
TargetSeq | GAAGACATAGTTTGTGAAGAA |
NCBI RefSeq | NM_021363 |
Alternative Names | Svp3; Svs3; Semg2; Svp-3; BB121242; 9530026M05Rik |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |