shRNA Lentivirus (self-inactivating), pU6-(Tatdn1-shRNA-Seq1)(CAT#: LV-SI2223WQ)

This product is a Tatdn1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Tatdn1 gene is putative deoxyribonuclease. The expression of Tatdn1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Tatdn1-shRNA-Seq1
Related Target/Protein Tatdn1
Region CDS
TargetSeq CAACCTGACAGATCCTATGTT
NCBI RefSeq NM_175151
Alternative Names CDA11
Titer >1*10^10 GC/mL
Target Gene
Gene ID 83940
Uniprot ID Q6P1N9

Related Products