shRNA Lentivirus (self-inactivating), pU6-(Tcte1-shRNA-Seq1)(CAT#: LV-SI1897WQ)
This product is a Tcte1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Tcte1 gene may play a role in the assembly of N-DRC and be required for sperm motility. The expression of Tcte1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Tcte1-shRNA-Seq1 |
| Related Target/Protein | Tcte1 |
| Region | CDS |
| TargetSeq | CCTCACCCACTAACAACTGTA |
| NCBI RefSeq | NM_013688 |
| Alternative Names | DRC5; D6S46; FAP155 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |