shRNA Lentivirus (self-inactivating), pU6-(TMEM156-shRNA-Seq2)(CAT#: LV-SI0160WQ)
This product is a TMEM156-shRNA encoding Lentivirus, which is based on HIV-1 serotype. TMEM156 is expressed in several tissues including ascites, bone marrow, salivary glands, and vascular to name a few. It should be noted this gene is not ubiquitously expressed, but is still evident in many tissues. This gene is predominately expressed in adults but there is a bit of expression in fetuses. The expression of TMEM156-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | TMEM156-shRNA-Seq2 |
| Related Target/Protein | TMEM156 |
| Region | CDS |
| TargetSeq | GTGGCAGAGTCATAGAGACAA |
| NCBI RefSeq | NM_024943 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer, liver cancer and prostate cancer |