shRNA Lentivirus (self-inactivating), pU6-(TMEM167B-shRNA-Seq2)(CAT#: LV-SI1505WQ)
This product is a TMEM167B-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by TMEM167B nvolved in the early part of the secretory pathway. The expression of TMEM167B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | TMEM167B-shRNA-Seq2 |
| Related Target/Protein | TMEM167B |
| Region | CDS |
| TargetSeq | GCTTGTGTTGTAATGGCCTTT |
| NCBI RefSeq | NM_020141 |
| Alternative Names | AD-020; C1orf119 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Prostate cancer |