shRNA Lentivirus (self-inactivating), pU6-(Tmub1-shRNA-Seq1)(CAT#: LV-SI2282WQ)
This product is a Tmub1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Tmub1 gene encodes a protein that may contribute to the regulation of translation during cell-cycle progression and cell proliferation. The expression of Tmub1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Tmub1-shRNA-Seq1 |
Related Target/Protein | Tmub1 |
Region | 3UTR |
TargetSeq | CTAGTTTCAAAGAGCTGCCTA |
NCBI RefSeq | NM_022418 |
Alternative Names | DULP; SB144; C7orf21 |
Titer | >1*10^10 GC/mL |
Related Diseases | Cancer |