shRNA Lentivirus (self-inactivating), pU6-(Tmub1-shRNA-Seq1)(CAT#: LV-SI2282WQ)

This product is a Tmub1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Tmub1 gene encodes a protein that may contribute to the regulation of translation during cell-cycle progression and cell proliferation. The expression of Tmub1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Tmub1-shRNA-Seq1
Related Target/Protein Tmub1
Region 3UTR
TargetSeq CTAGTTTCAAAGAGCTGCCTA
NCBI RefSeq NM_022418
Alternative Names DULP; SB144; C7orf21
Titer >1*10^10 GC/mL
Related Diseases Cancer
Target Gene
Gene ID 83590
Uniprot ID Q9BVT8

Related Products