shRNA Lentivirus (self-inactivating), pU6-(TRABD-shRNA-Seq2)(CAT#: LV-SI0249WQ)

This product is a TRABD-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The TRABD encodes metalloprotease that acts as a negative regulator of the Wnt signaling pathway by mediating the cleavage of the 8 N-terminal residues of a subset of Wnt proteins. The expression of TRABD-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert TRABD-shRNA-Seq2
Related Target/Protein TRABD
Region 3UTR
TargetSeq CCACCCAAATAAAGGATTATT
NCBI RefSeq NM_025204
Alternative Names LP6054; PP2447
Titer >1*10^10 GC/mL
Related Diseases Graves' Disease
Target Gene
Gene ID 80305
Uniprot ID Q9H4I3

Related Products