shRNA Lentivirus (self-inactivating), pU6-(TTC1-shRNA-Seq3)(CAT#: LV-SI0146WQ)
This product is a TTC1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The TTC1 gene encoded protein plays a role in protein-protein interactions, and binds to the Galpha subunit of G protein-coupled receptors to activate the Ras signaling pathway. The expression of TTC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | TTC1-shRNA-Seq3 |
Related Target/Protein | TTC1 |
Region | CDS |
TargetSeq | GAACTTGGTTCTCCGACCTTT |
NCBI RefSeq | NM_003314 |
Alternative Names | TPR1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Medullary Thyroid Cancer |