shRNA Lentivirus (self-inactivating), pU6-(TTC18-shRNA-Seq2)(CAT#: LV-SI0113WQ)
This product is a TTC18-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The TTC18 gene ecoded protein is a novel axoneme-binding protein that localizes at the base of the outer dynein arm and regulates ciliary motility. The expression of TTC18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | TTC18-shRNA-Seq2 |
| Related Target/Protein | TTC18 |
| Region | CDS |
| TargetSeq | CCTCCTAACTGAAGACAACAT |
| NCBI RefSeq | NM_145170 |
| Alternative Names | CFAP70 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Outer dynein arm (ODA) |