shRNA Lentivirus (self-inactivating), pU6-(VRTN-shRNA-Seq1)(CAT#: LV-SI0100WQ)
This product is a VRTN-shRNA encoding Lentivirus, which is based on HIV-1 serotype. VRTN is required for the development of thoracic vertebrae in mammals. VRTN is a novel DNA-binding transcription factor as it localizes exclusively in the nucleus, binds to DNA on a genome-wide scale and regulates the transcription of a set of genes that harbor VRTN binding motifs. The expression of VRTN-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | VRTN-shRNA-Seq1 |
Related Target/Protein | VRTN |
Region | CDS |
TargetSeq | CATTGCATCTCCCTGAACACA |
NCBI RefSeq | NM_018228 |
Alternative Names | vertnin; C14orf115 |
Titer | >1*10^10 GC/mL |
Related Diseases | Development of Thoracic Vertebrae in Mammals |