shRNA Lentivirus (self-inactivating), pU6-(WDR25-shRNA-Seq2)(CAT#: LV-SI0364WQ)

This product is a WDR25-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The WD domains of WDR25 gene are involved in protein-protein interactions in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The expression of WDR25-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert WDR25-shRNA-Seq2
Related Target/Protein WDR25
Region 3UTR
TargetSeq CTCAAGGGTAGATGAGAGGAA
NCBI RefSeq NM_024515
Alternative Names C14orf67
Titer >1*10^10 GC/mL
Target Gene
Gene ID 79446
Uniprot ID Q64LD2

Related Products