shRNA Lentivirus (self-inactivating), pU6-(WDR46-shRNA-Seq2)(CAT#: LV-SI0494WQ)
This product is a WDR46-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The WDR46 gene is required for localization of DDX21 and NCL to the granular compartment of the nucleolus. The expression of WDR46-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | WDR46-shRNA-Seq2 |
| Related Target/Protein | WDR46 |
| Region | CDS |
| TargetSeq | CTGGAGAGTAATCCATACAGA |
| NCBI RefSeq | NM_005452 |
| Alternative Names | UTP7; BING4; FP221; C6orf11 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Respiratory Disease |